Nauki przyrodnicze
MENU
STRONA GŁÓWNA
Przyroda polska
Zdjęcia natury
Fizyka teoretyczna
Biologia teoretyczna
Biochemia
Biologia molekularna
Ornitologia
Rośliny Polski
Botanika
Zoologia
Internetowe ZOO
Związki czynne roślin
Pierwiastki
chemiczne
Chemia nieorg.
Chemia organiczna
Ciekawostki
biologiczne
Ciekawostki
fizyczne
Ciekawostki
chemiczne
Ciekawe książki
Ciekawe strony www
Słownik

INFO
INFO O AUTORZE
KONTAKT

Do działu: BIOLOGIA TEORETYCZNA →

Ewolucja molekularna

Jedna zmiana przygotowuje drugą
Niccolo Machiavelli

WSTĘP

Wszystkie organizmy żyjące teraz i kopalne są ze sobą spokrewnione. Pozostaje jedynie kwestia bliskości tego pokrewieństwa.
Jak wiemy, około 4 miliardów lat temu, istniała prakomórka, od której wywodzi się cały biologiczny świat. O jej istnieniu świadczy wspólny dla tego świata kod genetyczny, materiał genetyczny (zawsze DNA) i podstawowe ścieżki metaboliczne. Pomimo dużych różnic między bakteriami, grzybami, roślinami i zwierzętami, te części wspólne jednoznacznie wskazują na wspólne pochodzenie.
Dla każdej pary gatunków istniał wspólny przodek. Im dalej spokrewnione są ze sobą dane gatunki, tym dawniej on istniał. Taksonomia filogenetyczna to taki naturalny sposób klasyfikowania organizmów, który ma odzwierciedlić ich prawdziwe pokrewieństwo ewolucyjne. To znaczy, że coraz wyższym taksonie (np. kolejno: rodzaju, rodzinie, rzędzie, itd) mają znajdować się stopniowo coraz to dalej spokrewnione organizmy.

Weźmy przykład czterech gatunków: szałwia łąkowa, szałwia lepka, melisa lekarska i werbena pospolita. Obydwie szałwie należą do tego samego rodzaju: szałwia. Są one w tej samej rodzinie jasnotowatych z melisą lekarską, ale w innych rodzajach. A trzy wspomniane już rośliny należą do wspólnego rzędu z werbeną.
A więc jeśli nasza klasyfikacja jest naturalna i odzwierciedla pokrewieństwa, to szałwia łąkowa jest najbliżej spokrewniona z szałwią lepką, potem z melisą lekarską, a na końcu - z werbeną pospolitą. Bo im wyższy takson, tym mniej spokrewnione organizmy.

drzewo ewolucyjne

Co może być wygodną miarą pokrewieństwa ewolucyjnego organizmów? Z jednej strony potrafią się one od siebie bardzo różnić (np. prawdziwek, jodła, wieloryb), a z drugiej - cechuje je, wspomniana już, uniwersalność podstawowych rozwiązań biochemicznych. Czy jest coś pośredniego?
Przyjrzyjmy się bliżej DNA. Kwas dezoksyrybonukleinowy stanowi uniwersalny materiał do zapisu informacji genetycznej. Składa się on z czterech rodzajów części: A, G, T i C. Te części mogą układać się w różne sekwencje, niczym korale o 4 kolorach, w różnych kolejnościach nawlekane na nić.

A więc DNA to nazwa zbiorcza. Kwasy dezoksyrybonukleinowe mogą różnić się od siebie konkretną sekwencją, np.:
5' AGTCCC 3' oraz 5' ACTCGC 3'
Gdy linie ewolucyjne gatunków rozdzielają się, to ich pule genetyczne zaczynają gromadzić niezależne (a więc różne) zmiany - mutacje. Dokładnie rzecz ujmując, zmiany te dotyczą sekwencji DNA genów. W konsekwencji, po pewnym czasie, w obydwu rozdzielonych populacjach, będziemy obserwować sekwencje podobne, ale nieidentyczne z tymi, które istniały w wyjściowej populacji.

Na przykład:
5' ACTCCC 3'   sekwencja populacji wyjściowej - przodka
5' AGTCCC 3'   sekwencja w jednej potomnej populacji po rozdziale
5' ACTCTC 3'   sekwencja w drugiej potomnej populacji po rozdziale

NIEZALEŻNA KUMULACJA ZMIAN

Wiemy już, że przodek organizmów dalej spokrewnionych istniał wcześniej niż przodek organizmów spokrewnionych bliżej. A więc w przypadku dalszego pokrewieństwa było więcej czasu na kumulację zmian w DNA. Czyli sekwencje genów organizmów dalej spokrewnionych powinny różnić się bardziej (większą liczbą nagromadzonych mutacji). Oto nasza miara pokrewieństwa i uciekającego w toku ewolucji czasu.

Zestawmy teraz hipotetyczne fragmenty sekwencji genów, pochodzących z trzech różnych gatunków:

Gat 1 5' GTGAACTGATCGGTTACCTTA 3'
Gat 2 5' GTCAATTGATCTATCAGGTTA 3'
Gat 3 5' CTCTGTTAAT   GCTCAGGCCA 3'

Są one podobne, ale nie identyczne. W toku ewolucji, nagromadzone zostały na tym odcinku mutacje typu substytucji (podmiany) i jedna delecja (wypadnięcie).

Gatunki 1 i 2

Gat 1 5' GTGAACTGATCGGTTACCTTA 3'
Gat 2 5' GTCAATTGATCTATCAGGTTA 3'

Sekwencje powyższe różnią się w 7 miejscach (podkreślone).
Zauważmy, że liczba obserwowanych substytucji może być mniejsza od tej, która mogła zajść w rzeczywistości, np.:
G→A→C oraz G→C - mimo sumarycznie trzech substytucji, nie będzie różnicy pomiędzy sekwencjami w danym miejscu na DNA
G→A→T oraz G→C - mimo sumarycznie trzech substytucji, będzie tylko 1 różnica między sekwencjami w danym miejscu na DNA

Gatunki 1 i 3

Gat 1 5' GTGAACTGATCGGTTACCTTA 3'
Gat 3 5' CTCTGTTAAT   GCTCAGGCCA 3'

Liczba różnic dla tej pary sekwencji wynosi 13. Zauważmy, że tutaj istnieje jedna delecja. Na szczęście, istnieją programy komputerowe, które potrafią zbadać jak można zestawić sekwencje, biorąc pod uwagę delecje lub insercje (wstawienia). Gdyby potraktować sekwencję gatunku 3 jako ciągłą od miejsca delecji, to nic począwszy od tego miejsca nie zgadzałoby się i otrzymalibyśmy zbyt dużą, nierzeczywistą liczbę mutacji typu substytucji.
Gatunki 2 i 3

Gat 2 5' GTCAATTGATCTATCAGGTTA 3'
Gat 3 5' CTCTGTTAAT   GCTCAGGCCA 3'

Liczba mutacji wynosi w tym przypadku 9. Należny wnioskować, że gatunki 1 i 2 są bliżej spokrewnione ze sobą (mniejsza liczba różnic), a gatunek 3 jest odleglejszy.
W następnym podrozdziale poznamy nowoczesną metodę badania pokrewieństw i budowania drzew ewolucyjnych.

MAKSYMALNA OSZCZĘDNOŚĆ

Metoda ta nosi nazwę maksymalnej parsymonii, czyli maksymalnej oszczędności. Zastosujmy ją na zestawie fragmentów sekwencji genowych:

Gat 1 5' ACTTG 3'
Gat 2 5' AGTTG 3'
Gat 3 5' CGATA 3'
Gat 4 5' CCATA 3'

A teraz spróbujmy utworzyć dwa możliwe drzewa ewolucyjne tylko dla pojedynczego "słupka" na sekwencjach, zaznaczonego powyżej na czerwono:

metoda maksymalnej parsymonii

Zauważmy, że drzewo po lewej wymaga jednej mutacji, a drzewo po prawej - aż dwóch. Metoda maksymalnej parsymonii zakłada maksymalną oszczędność mutacji. Komputer, spośród wszystkich możliwych drzew dla danego "słupka" wybiera to, które wymaga najmniej zmian. Wygrywa to drzewo, które przy analizie wszystkich "słupków" wybierane jest najczęściej. W naszym przypadku jest to drzewo po lewej. Zauważmy jednak, że w przypadku drugiego "słupka" drzewo to nie jest zwycięskie. Ale w większości przypadków jest i właśnie to drzewo obrazuje nam naturalne drogi ewolucyjne, prowadzące do gatunków 1,2,3 i 4.

MOLEKULARNY ZEGAR EWOLUCJI

Skoro sekwencje genowe z czasem kumulują coraz więcej mutacji, to mogą one służyć jako swoisty zegar, który odlicza czas. Zegar ten trzeba jednak wykalibrować, to znaczy przypisać (średnio) jednej mutacji odpowiedni interwał czasu. Okazuje się, że nie jest to takie proste. Szybkość "bicia" zegara zależy bowiem od konkretnego genu. Niektóre geny tolerują i kumulują więcej zmian niż inne.
Istnieją bowiem białka, które w toku ewolucji weszły w tyle interakcji, że prawie każda zmiana ich sekwencji zostaje wyeliminowana jako niedostosowawcza i w konsekwencji - białko takie mało się z czasem zmienia.
Stała szybkość mutacji jest zatem bardzo śmiałym założeniem i ma ono sens tylko wtedy, gdy uśrednimy dane z bardzo wielu różnych białek. Można też próbować kalibrować zegar molekularny dla każdego białka z osobna. Na przykład: zegar białka - cytochromu c, po kalibracji pokazuje jedną zmianę na 17,6 milionów lat.
Kalibracja jest możliwa dzięki poznaniu liczby zmian w sekwencjach genów z gatunków, których przybliżony czas rozejścia się jest znany z danych paleontologicznych.
Po kalibracji możemy zacząć obliczenia. Przykładowo: średnia różnica pomiędzy gadzimi a ssaczymi cytochromami c to 14,8 zmian. Mamy więc z proporcji:

1/17,6 = 14,8/x   →  x = około 300 mln lat

Z tego wynika, że linia prowadząca do współczesnych ssaków oddzieliła się od gadziej około 300 mln lat temu. Średnia liczba zmian dla cytochromów c z roślin i zwierząt wynosi 45, co odpowiada czasowi rozejścia się: 792 mln lat temu, czyli w prekambrze.

TRANSFER HORYZONTALNY

Aby badać drogi ewolucyjne zwierząt i roślin, trzeba znać sekwencje genów występujących w obydwu tych grupach organizmów. Ale istnieją wyjątki, których badanie wprowadziłoby nas w błąd. Weźmy na przykład hemoglobinę - barwnik krwi charakterystyczny dla kręgowców. Okazało się, że w rodzinie roślin motylkowatych znaleziono leghemoglobinę - białko zbyt podobne do hemoglobiny, by podobieństwo to mogło wynikać z pochodzenia od wspólnego przodka kręgowców i roślin. Gdybyśmy analizowali te białka, wyciągnęlibyśmy błędny wniosek, że przodek ten żył bardzo niedawno temu.
Na czym polega tajemnica tego zjawiska? Leghemoglobina występuje nie u wszystkich roślin, a jedynie w rodzinie motylkowatych. Jest więc wysoce nieprawdopodobne, aby istniała ona jeszcze przed oddzieleniem się roślin od zwierząt, bo wtedy wszystkie rośliny miałyby ją. Zjawisko to wyjaśniane jest obecnie przez tzw. transfer horyzontalny od zwierząt do wspólnego przodka motylkowatych.

transfer horyzontalny

Mechanizm tego transferu nie jest do końca jasny. Prawdopodobnie gen leghemoglobinowy został pobrany i przeniesiony na rośliny motylkowate przez bakterie.

NEUTRALIZM JAPOŃSKI

Jest rzeczą zrozumiałą uważać, że kumulujące się mutacje w sekwencjach genowych (genotypie) odzwierciedlą się w różnicach pomiędzy cechami organizmów (fenotypie). Jeśli mutacja genu spowoduje podmianę aminokwasu w kodowanym białku i zmieni to wyraźnie jego działanie, to mamy do czynienia z mutacją nieneutralną. Mutacja taka może też wyłączyć działanie istotnego dla życia białka. Dlatego kumulacja mutacji nieneutralnych jest niższa niż szybkość ich powstawania. To jasne. Na niektóre po prostu działa dobór naturalny i odrzuca upośledzone mutanty, co stanowi przeszkodę w ich przetrwaniu. Mutacja nieneutralna może być również korzystna i wpływać na zwiększenie liczby potomstwa mutanta. Takie zmiany są jednak bardzo rzadkie; przeważają te niekorzystne.

Motoo Kimura - japoński biolog uważa, że większość mutacji, obserwowanych w sekwencjach ma charakter neutralny. Nie są one odrzucane przez dobór, bo nie mają istotnego wpływu na funkcjonowanie białek.
Zastanówmy się gdzie mogą znaleźć się takie mutacje. Na pewno na odcinkach DNA pomiędzy genami, a wewnątrz genów - w niekodujących intronach. Poza tym, w wyniku tzw. degeneracji kodu genetycznego (kilka kodonów może kodować ten sam aminokwas) mutacja może zmienić kodon, nie zmieniając aminokwasu w białku, czyli nie zmieniając białka w ogóle. Mutacja może także zmienić aminokwas, ale na taki, który istotnie nie wpływa na właściwości białka.
We wszystkich tych przypadkach na mutacje nie będzie działał dobór naturalny i będą się one kumulować szybciej niż zmiany nieneutralne.
Kimura obalił swoim neutralizmem dogmat mówiący, że na menu zmienności mutacyjnej zawsze działa dobór naturalny, decydując o przeżywalności mutacji, dających najwyższą dostosowawczość. Teoria neutralizmu Kimury mówi nam, że większość mutacji utrwala się zupełnie przypadkowo, bo nie mają one wpływu na organizm mutanta, więc nie mogą zostać "zauważone" przez dobór naturalny. Badania z dziedziny genetyki molekularnej przyznały Kimurze rację.
Warto tu też nadmienić, że są mutacje neutralne, które mogą być lepszym od innych podłożem dla przyszłych mutacji nieneutralnych. A więc, mimo neutralności, różnią się one potencjałem.

ZAKOŃCZENIE

Naukowcy stworzyli już wiele drzew ewolucyjnych, aby dowiedzieć się jakie są rzeczywiste pokrewieństwa pomiędzy gatunkami. Żadne z drzew nie jest pełne, bo obejmuje najwyżej kilkanaście gatunków, a tych na Ziemi mamy 20-40 milionów. Taka cząstkowość może zrodzić przekonanie, że tylko podobne do siebie gatunki są spokrewnione, a pozostałe nie wykazują już pokrewieństwa. Nie jest to prawda. Wszystkie gatunki żyjące na Ziemi są ze sobą dalej lub bliżej spokrewnione, a drzewka ewolucyjne są tak naprawdę gałązkami jednego wielkiego drzewa ziemskiej biosfery. Wszystkie gałązki zbiegają się do jednego pnia, u którego podnóża znajduje się prakomórka - praprzodek wszelkiego życia na Ziemi, który istniał około 4 miliardów lat temu.

MACIEJ PANCZYKOWSKI

 Autor wortalu: Maciej Panczykowski, Copyright © 2003-2018 by Maciej Panczykowski